| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.108602 |
| Chromosome: | chromosome 1 |
| Location: | 7393946 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g053150 | GPDH3,GPD3 | (1 of 3) K00006 - glycerol-3-phosphate dehydrogenase (NAD+) (GPD1); Glycerol-3-phosphate dehydrogenase/dihydroxyacetone-3-phosphate reductase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCAGATGCAACTGAGAAACAGTGATAGCT |
| Internal bar code: | GTGAAGGGTGATGGAGACGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 767 |
| LEAP-Seq percent confirming: | 98.2537 |
| LEAP-Seq n confirming: | 1069 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACACACACACACACCG |
| Suggested primer 2: | GTGTCAACTCATGTGACGGG |