| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.108607 |
| Chromosome: | chromosome 10 |
| Location: | 2584908 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g437050 | ATP11 | (1 of 1) K07555 - ATP synthase mitochondrial F1 complex assembly factor 1 (ATPeAF1, ATPAF1, ATP11); Assembly factor 1 for F1 component of mitochondrial ATP synthase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGGACCAGTTCTGTGACTGAATCCCCAG |
| Internal bar code: | GAACGGAAACGATGGAGCGTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 523 |
| LEAP-Seq percent confirming: | 99.5584 |
| LEAP-Seq n confirming: | 1578 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAGTGCATGACTAGCTGGG |
| Suggested primer 2: | CATTCAAAAGCTCCTCTGCC |