Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.108626 |
Chromosome: | chromosome 13 |
Location: | 2555459 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g580750 | (1 of 1) K16274 - E3 ubiquitin-protein ligase AIP2 [EC:6.3.2.19] (AIP2) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGGACAGGGTTTGGACATGCGCACGCAT |
Internal bar code: | GGTGGACGAGCTCCTAAGACTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 700 |
LEAP-Seq percent confirming: | 99.5984 |
LEAP-Seq n confirming: | 744 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACAGCGGTGAAGTCGGTTAG |
Suggested primer 2: | GTGGCGTATGGGTATGCTCT |