| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.108630 |
| Chromosome: | chromosome 16 |
| Location: | 4905993 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g685650 | GLR1 | Ionotropic glutamate receptor; (1 of 4) PF00060//PF00497 - Ligand-gated ion channel (Lig_chan) // Bacterial extracellular solute-binding proteins, family 3 (SBP_bac_3) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTAGCTGCTGACATTATTATAACAGGGTT |
| Internal bar code: | GTTTGCGTGTCCCCCCGACATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 691 |
| LEAP-Seq percent confirming: | 99.0909 |
| LEAP-Seq n confirming: | 2507 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTCTGTCAACCAACCTCGT |
| Suggested primer 2: | TGTACTGGGAGTGTGGGACA |