| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.108653 |
| Chromosome: | chromosome 2 |
| Location: | 7630414 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g143400 | PDE27 | (1 of 1) K18437 - high affinity cAMP-specific and IBMX-insensitive 3',5'-cyclic phosphodiesterase 8 (PDE8); 3'%252C5'-cyclic-nucleotide phosphodiesterase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTACAAGCGGGGACAATCCGCGTGTGCAAA |
| Internal bar code: | CGTTGGATGTGGGGCTACCGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 857 |
| LEAP-Seq percent confirming: | 98.8599 |
| LEAP-Seq n confirming: | 2688 |
| LEAP-Seq n nonconfirming: | 31 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTATCAGTTGCACGCAAAGC |
| Suggested primer 2: | GCTGAGAGAAACGGGAAGTG |