Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.108676 |
Chromosome: | chromosome 17 |
Location: | 5154420 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g735400 | VPS2B | Subunit of the ESCRT-III complex; (1 of 1) K12192 - charged multivesicular body protein 2B (CHMP2B) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTGATTGAAGAGTATGTTCCTCGTTGCCA |
Internal bar code: | CTATTGCCGCTCGCTTTCTTAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 248 |
LEAP-Seq percent confirming: | 95.2381 |
LEAP-Seq n confirming: | 320 |
LEAP-Seq n nonconfirming: | 16 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTTACGGGATTGGTTCAGA |
Suggested primer 2: | CGTGTTCTCCAGGTTGGTTT |