| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.108817 |
| Chromosome: | chromosome 8 |
| Location: | 21612 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g358250 | PPR14,MCA1 | (1 of 2) PF01535//PF13041//PF13812 - PPR repeat (PPR) // PPR repeat family (PPR_2) // Pentatricopeptide repeat domain (PPR_3); petA mRNA stabilization factor | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGCATTAACCGATCAAACCCACGCACTAC |
| Internal bar code: | AGGCGCACAGTGCTCACGGTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 253 |
| LEAP-Seq percent confirming: | 94.9447 |
| LEAP-Seq n confirming: | 601 |
| LEAP-Seq n nonconfirming: | 32 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTAATGCACTTCCCCGTGTT |
| Suggested primer 2: | CAAAGTTCAGGGTCGGTCAT |