Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.108817 |
Chromosome: | chromosome 8 |
Location: | 21661 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g358250 | PPR14,MCA1 | (1 of 2) PF01535//PF13041//PF13812 - PPR repeat (PPR) // PPR repeat family (PPR_2) // Pentatricopeptide repeat domain (PPR_3); petA mRNA stabilization factor | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTAGGGCAAAGGTGATGCCCGGATAGTC |
Internal bar code: | ACGCCGGTACCGTCCTTCTGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 628 |
LEAP-Seq percent confirming: | 94.7761 |
LEAP-Seq n confirming: | 1778 |
LEAP-Seq n nonconfirming: | 98 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTAATGCACTTCCCCGTGTT |
Suggested primer 2: | CAAAGTTCAGGGTCGGTCAT |