| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.108818 |
| Chromosome: | chromosome 1 |
| Location: | 3434923 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g021950 | (1 of 1) PF08393//PF12777//PF12781 - Dynein heavy chain, N-terminal region 2 (DHC_N2) // Microtubule-binding stalk of dynein motor (MT) // ATP-binding dynein motor region D5 (AAA_9) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCACGCCCCGCTACCCGCTACCCGCTACCC |
| Internal bar code: | GTGTCAAAAGCAAGGTTTCCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 81 |
| LEAP-Seq percent confirming: | 98.4981 |
| LEAP-Seq n confirming: | 787 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAATGCTGGTGTGGTCTCTG |
| Suggested primer 2: | GCACTCGGCTGTCTTTGAG |