| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.108822 |
| Chromosome: | chromosome 3 |
| Location: | 6579200 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g196050 | B9D2A | (1 of 1) K16745 - B9 domain-containing protein 2 (B9D2); B9 Domain-Containing transition zone protein 2 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGTTGGAGTGGGTAGAGGCATCGCCGGT |
| Internal bar code: | AGCCTTGGGTCATCTCAGGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 629 |
| LEAP-Seq percent confirming: | 76.5957 |
| LEAP-Seq n confirming: | 36 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACTAGGGGAAAGCGGTAGG |
| Suggested primer 2: | CCATCCACTTGACCTCCACT |