Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.108868 |
Chromosome: | chromosome 7 |
Location: | 1369251 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g322450 | HLM13 | putative N-methyltransferase; (1 of 1) PF00855//PF00856 - PWWP domain (PWWP) // SET domain (SET) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCCGCTCTAGGGCCCAGCTGCTGATTAG |
Internal bar code: | ACACGGCACGGGCGAAGTGCAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 574 |
LEAP-Seq percent confirming: | 99.0248 |
LEAP-Seq n confirming: | 1117 |
LEAP-Seq n nonconfirming: | 11 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGGTGCCGAAGAACATTAC |
Suggested primer 2: | GTTTAGAGGGCTTGCTGCTG |