| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.108936 |
| Chromosome: | chromosome 13 |
| Location: | 4371911 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g602901 | CNX2 | (1 of 1) PTHR22960:SF0 - MOLYBDENUM COFACTOR BIOSYNTHESIS PROTEIN 1; Cofactor of nitrate reductase and xanthine dehydrogenase 2 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGCGGGTGCGCCTCCGCAGCGGTCGCCG |
| Internal bar code: | TAGTTGGTGAGGTGCGGAACCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 721 |
| LEAP-Seq percent confirming: | 98.6398 |
| LEAP-Seq n confirming: | 2103 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCAGAGTCGTAAACGGTGC |
| Suggested primer 2: | GAGACCTCATGCGAGAGTCC |