| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.108990 |
| Chromosome: | scaffold 19 |
| Location: | 134387 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre19.g750847 | (1 of 1) PTHR10264//PTHR10264:SF27 - BAND 7 PROTEIN-RELATED // STOMATIN-LIKE PROTEIN 2, MITOCHONDRIAL | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTGCGTATGCCAGCCCTTTCCCTTCGTG |
| Internal bar code: | CCGTACCACCCCGGGGCGTCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 136 |
| LEAP-Seq percent confirming: | 96.338 |
| LEAP-Seq n confirming: | 684 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGTCTTAGGGAGGGGGAAG |
| Suggested primer 2: | CGACTGGAAAGTGGAGAAGC |