Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.108990 |
Chromosome: | scaffold 19 |
Location: | 134387 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre19.g750847 | (1 of 1) PTHR10264//PTHR10264:SF27 - BAND 7 PROTEIN-RELATED // STOMATIN-LIKE PROTEIN 2, MITOCHONDRIAL | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACACACACGTTGACATCACACAAACAACC |
Internal bar code: | ATGTGTGTCAACCCCTGGTTGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 275 |
LEAP-Seq percent confirming: | 99.7074 |
LEAP-Seq n confirming: | 7498 |
LEAP-Seq n nonconfirming: | 22 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGTCTTAGGGAGGGGGAAG |
Suggested primer 2: | CGACTGGAAAGTGGAGAAGC |