| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.109007 |
| Chromosome: | chromosome 3 |
| Location: | 1775280 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g154050 | ABCA1B | putative ABC transporter; (1 of 173) IPR029058 - Alpha/Beta hydrolase fold | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGATGCGGACCGCTGAGGCCACACGAAAAC |
| Internal bar code: | CCAACACCTCGACCCTTATGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1037 |
| LEAP-Seq percent confirming: | 99.2599 |
| LEAP-Seq n confirming: | 2146 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGATGGGGAGGATAAGTGGT |
| Suggested primer 2: | AGGAACGTGAGTTTGTTGGG |