| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.109033 |
| Chromosome: | chromosome 5 |
| Location: | 2959345 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g238290 | DRP7 | (1 of 1) PF00350//PF01031//PF02212 - Dynamin family (Dynamin_N) // Dynamin central region (Dynamin_M) // Dynamin GTPase effector domain (GED); Dynamin-related GTPase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAACACGTCGCTGTCCTCCATGCCCAGCAG |
| Internal bar code: | TAGCTCATGTCCTAACTCACCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 706 |
| LEAP-Seq percent confirming: | 94.6086 |
| LEAP-Seq n confirming: | 5282 |
| LEAP-Seq n nonconfirming: | 301 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCTGTAAGTCCATGTCGGT |
| Suggested primer 2: | CAAGCGCCGGAGTAGATAAG |