Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.109039 |
Chromosome: | chromosome 17 |
Location: | 245949 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g697950 | AAA3 | Plastidic ADP/ATP translocase; (1 of 2) PTHR31187:SF1 - ADP,ATP CARRIER PROTEIN 1, CHLOROPLASTIC-RELATED | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTACGGTGTCGGCCAGGCGTGCTGACCC |
Internal bar code: | GTATGTGGAAGTGCCCACCGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 179 |
LEAP-Seq percent confirming: | 99.7222 |
LEAP-Seq n confirming: | 359 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGATGGTGTTGACAAAGGC |
Suggested primer 2: | TCTTCAATATGCCGAGGGTC |