| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.109092 |
| Chromosome: | chromosome 5 |
| Location: | 3349599 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g240700 | FAP378 | Flagellar Associated Protein 378; (1 of 1) PF00530//PF05572 - Scavenger receptor cysteine-rich domain (SRCR) // Pregnancy-associated plasma protein-A (Peptidase_M43) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCAGGAGCCCCTATGGGCCCGGGCTACA |
| Internal bar code: | GAGATTGGTAATCATTCTGCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 730 |
| LEAP-Seq percent confirming: | 74.0458 |
| LEAP-Seq n confirming: | 291 |
| LEAP-Seq n nonconfirming: | 102 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAATTCCATAACCAATGCC |
| Suggested primer 2: | TACGTGGCACCATAGCACAT |