| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.109130 |
| Chromosome: | chromosome 1 |
| Location: | 6422345 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g045650 | ZNJ3 | DnaJ-like zinc-finger protein; (1 of 17) IPR001305 - Heat shock protein DnaJ, cysteine-rich domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTCCTCGCCTGCGCGCCAGCGTAACAAGG |
| Internal bar code: | TATACAAACAAGCTCAGAATGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 644 |
| LEAP-Seq percent confirming: | 99.135 |
| LEAP-Seq n confirming: | 3782 |
| LEAP-Seq n nonconfirming: | 33 |
| LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAGATAGGTAAGCGGGTGC |
| Suggested primer 2: | CTCAATTGGTTGACCACACG |