| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.109236 |
| Chromosome: | chromosome 10 |
| Location: | 3730672 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g446400 | VPS4,KATL1,KAT3,KAT2 | (1 of 1) PTHR23074//PTHR23074:SF78 - AAA ATPASE // KATANIN P60 ATPASE-CONTAINING SUBUNIT A-LIKE 2; Katanin like protein 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGGCTGGATGGAGCAGGCGGCCGGCAGGC |
| Internal bar code: | GAAATTTCAAGGTACCTTGCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 450 |
| LEAP-Seq percent confirming: | 99.0196 |
| LEAP-Seq n confirming: | 808 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTCCTCCATTGTTGCACCT |
| Suggested primer 2: | GGGAATTGTTCGTGCTGTTT |