Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.109314 |
Chromosome: | chromosome 14 |
Location: | 1731401 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g619613 | (1 of 1) PF04855 - SNF5 / SMARCB1 / INI1 (SNF5) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGAGTACAGGTTTGGTGACGGGGCCCCC |
Internal bar code: | AGGGTATTTCGCTATGATTCTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 148 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 404 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCCTGTGTGCCCTCTCTCT |
Suggested primer 2: | AGGAGTTGGGAGGGTGAGTT |