| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.109365 |
| Chromosome: | chromosome 8 |
| Location: | 574080 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g359500 | (1 of 1) 6.3.2.4 - D-alanine--D-alanine ligase / D-alanylalanine synthetase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCCTCCCCTCGGACGCATGGCCCACCTC |
| Internal bar code: | CTACGCTCTCCACTAGATGACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 505 |
| LEAP-Seq percent confirming: | 51.1632 |
| LEAP-Seq n confirming: | 5828 |
| LEAP-Seq n nonconfirming: | 5563 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCACCAAAGCACAAAGGGT |
| Suggested primer 2: | CCAGCCTCCATATCCTGTGT |