Insertion junction: LMJ.RY0402.109428_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.109428
Chromosome:chromosome 3
Location:8399971
Confidence (%):58
Locus systematic id Locus common name Defline Feature
intergenic

Insertion site details

Expected flanking sequence (starting at cassette; orientation from cassette outwards): TGTGAGCTGGGCCCAAACCTTTTTAGATTT
Internal bar code:TGGTCGGGTTACGGACGCTGGA

Confirmation - LEAP-Seq

LEAP-Seq distance:95
LEAP-Seq percent confirming:70.0
LEAP-Seq n confirming:7
LEAP-Seq n nonconfirming:3
LEAP-Seq n unique pos:2

Suggested primers for confirmation by PCR

Suggested primer 1:TGTAATAGTGCCCACCACCA
Suggested primer 2:CTAGTGCTGCACGTAACGGA