| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.109438 |
| Chromosome: | chromosome 12 |
| Location: | 8267564 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g550200 | SMM44 | (1 of 2) 2.1.1.9 - Thiol S-methyltransferase; S-adenosyl-L-methionine-dependent methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAATTGAGACTGCTTATTGAGGCAATGGT |
| Internal bar code: | TCTGAGCACGACGTGTATGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 488 |
| LEAP-Seq percent confirming: | 90.0264 |
| LEAP-Seq n confirming: | 23559 |
| LEAP-Seq n nonconfirming: | 2610 |
| LEAP-Seq n unique pos: | 58 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCTATCGTATCCACCACCA |
| Suggested primer 2: | GCACCTTCCAGAAGAACTCG |