| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.109487 |
| Chromosome: | chromosome 3 |
| Location: | 4996549 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g180300 | SIR3 | (1 of 1) 1.8.1.2 - Assimilatory sulfite reductase (NADPH) / Sulfite reductase (NADPH); Sulfite reductase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCAGGCGCATGCACCACCCACCTGATGTC |
| Internal bar code: | GTACCTGCCTGAAGGCGCCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 688 |
| LEAP-Seq percent confirming: | 99.0419 |
| LEAP-Seq n confirming: | 827 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAGCCTCAAAGATGCAGGT |
| Suggested primer 2: | TTCACCCTTCCATCTGAACC |