| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.109490 |
| Chromosome: | chromosome 5 |
| Location: | 3154385 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g239450 | (1 of 3) K14165 - atypical dual specificity phosphatase [EC:3.1.3.16 3.1.3.48] (K14165) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCACACATGATTACTTGGAACCTGTCGG |
| Internal bar code: | CGTGTTGCGTTTTGGCAGCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 508 |
| LEAP-Seq percent confirming: | 98.8418 |
| LEAP-Seq n confirming: | 8193 |
| LEAP-Seq n nonconfirming: | 96 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCAGGACATACTTGGGCTG |
| Suggested primer 2: | CAAGGCATGGGAATGCTTAT |