| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.109505 |
| Chromosome: | chromosome 3 |
| Location: | 5318043 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g183850 | FDX6 | (1 of 1) IPR001041//IPR010241//IPR012675 - 2Fe-2S ferredoxin-type iron-sulfur binding domain // Ferredoxin [2Fe-2S], plant // Beta-grasp domain; Apoferredoxin, chloroplast precursor | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTCATATGCTCAACCCAGTCCTGATGAGG |
| Internal bar code: | GTTATCGCCGATAGCACTGGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1440 |
| LEAP-Seq percent confirming: | 99.8755 |
| LEAP-Seq n confirming: | 802 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCTTACGTGTCCCCTCTGG |
| Suggested primer 2: | GAAGTTGAGAAGGGCGACAG |