| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.109542 |
| Chromosome: | chromosome 13 |
| Location: | 1369653 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g571700 | CDPK9 | (1 of 1) PF00069//PF07714//PF13499 - Protein kinase domain (Pkinase) // Protein tyrosine kinase (Pkinase_Tyr) // EF-hand domain pair (EF-hand_7); Calcium/calmodulin-dependent protein kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGCGTCCCTCGGTCGGTCCACTGACAGC |
| Internal bar code: | AGAATTTCGGCGTTCGTGCGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 929 |
| LEAP-Seq percent confirming: | 99.5463 |
| LEAP-Seq n confirming: | 3291 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGAGGAGCTCGACAAGGT |
| Suggested primer 2: | GGCCGTCCTATTGTCACCTA |