| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.109563 |
| Chromosome: | chromosome 6 |
| Location: | 3941942 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278187 | MOT4 | (1 of 1) K15716 - E3 ubiquitin-protein ligase ZSWIM2 [EC:6.3.2.19] (ZSWIM2); Predicted protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCGTGTAAGCCGGCAGCGGTGCTATTTA |
| Internal bar code: | CCGTAGACGTTACCCTCGATAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 673 |
| LEAP-Seq percent confirming: | 99.4856 |
| LEAP-Seq n confirming: | 967 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTTTCGCCTCAATACGGT |
| Suggested primer 2: | TCACGAACAGCGAGTGTAGG |