| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.109597 |
| Chromosome: | chromosome 2 |
| Location: | 4113285 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g097800 | HLA3,MRP1 | (1 of 18) 3.6.3.44 - Xenobiotic-transporting ATPase / Steroid-transporting ATPase; Bicarbonate ABC transporter | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAGCCAGGGGTTCTGCGGCACGTAGGAG |
| Internal bar code: | TGCCGGATAGTATGACGGCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 637 |
| LEAP-Seq percent confirming: | 92.0326 |
| LEAP-Seq n confirming: | 3731 |
| LEAP-Seq n nonconfirming: | 323 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTAGGCAGTCAGCTTCTGG |
| Suggested primer 2: | GCCTCAACTTCTGGAACTGC |