Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.109671 |
Chromosome: | chromosome 10 |
Location: | 6502749 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g466550 | TF2H1 | General transcription factor IIH subunit 1; (1 of 1) IPR005607//IPR027079 - BSD domain // TFIIH subunit Tfb1/p62 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCGGGGCTGCCCGCTCCCCTGCCAGCAC |
Internal bar code: | TATGCGGATCATCGGAGAATCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 481 |
LEAP-Seq percent confirming: | 99.0826 |
LEAP-Seq n confirming: | 1296 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTATTCATGTCACGCGCACT |
Suggested primer 2: | ATAAAGGGAGGGAACGGAGA |