| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.109700 |
| Chromosome: | chromosome 4 |
| Location: | 2101909 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g219350 | PLC1 | (1 of 14) IPR017946 - PLC-like phosphodiesterase, TIM beta/alpha-barrel domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTAATTTTCGAGAAGCGTCTGGCGTTTTC |
| Internal bar code: | GGAATTTAATTGGCCCGCTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 464 |
| LEAP-Seq percent confirming: | 99.5274 |
| LEAP-Seq n confirming: | 8635 |
| LEAP-Seq n nonconfirming: | 41 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGCATAGGGTGTGTATGTG |
| Suggested primer 2: | AGCGTCAAGCTGGAGAACAT |