| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.109725 |
| Chromosome: | chromosome 14 |
| Location: | 2326220 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g623650 | ADH7 | Alcohol dehydrogenase; (1 of 3) 1.1.1.2 - Alcohol dehydrogenase (NADP(+)) / Aldehyde reductase (NADPH) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAGTTAGGCCAGAGAGTCAGGCACGGAAG |
| Internal bar code: | ACGCTGCAGCAGCCCCGTTTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 625 |
| LEAP-Seq percent confirming: | 99.1855 |
| LEAP-Seq n confirming: | 2192 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATACGTGCGTGTGTGATCGT |
| Suggested primer 2: | GCTGCTACTGCCGCTTTACT |