| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.109883 |
| Chromosome: | chromosome 5 |
| Location: | 997918 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g246600 | (1 of 1) IPR001781//IPR027377 - Zinc finger, LIM-type // Zinc-binding domain | gene_edge/mRNA_edge/3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGCGCGATTGCTGCCATGGGAAGTCCGC |
| Internal bar code: | TCGACCATCTCTTCATTCTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1068 |
| LEAP-Seq percent confirming: | 99.5333 |
| LEAP-Seq n confirming: | 853 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGAATAGCCCAGCTTCTG |
| Suggested primer 2: | GTGTGATGGGATGACAGTGC |