| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.109887 |
| Chromosome: | chromosome 2 |
| Location: | 5041924 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g104500 | CDJ4 | (1 of 2) IPR001080 - 3Fe-4S ferredoxin; Chloroplast DnaJ-like protein 4 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCTGGGGTTCCCACGCATGTGCCCGGTGA |
| Internal bar code: | GCAGAGGGTTTCGGTAGCGCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 463 |
| LEAP-Seq percent confirming: | 99.2665 |
| LEAP-Seq n confirming: | 1624 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACACCATTACCAACAGCG |
| Suggested primer 2: | CGCTTCCTGCTGACAACATA |