| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.109909 |
| Chromosome: | chromosome 3 |
| Location: | 549334 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g145407 | (1 of 2) IPR000571//IPR002110//IPR020683 - Zinc finger, CCCH-type // Ankyrin repeat // Ankyrin repeat-containing domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGAAATGATCTGCGCAGGCCGTGGCGAGC |
| Internal bar code: | GCTCGCTCGCCGGTTGAAGTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 463 |
| LEAP-Seq percent confirming: | 99.2448 |
| LEAP-Seq n confirming: | 1577 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTTGACAGCAAATGATCGC |
| Suggested primer 2: | GAGCGATTAGGTGAGTTCGC |