Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.110077 |
Chromosome: | chromosome 16 |
Location: | 5102308 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g683950 | SRRA1,SRP1 | Alpha Subunit of the SRP Receptor | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGAATGTTCGCACGGAGTGTAAGGCGAT |
Internal bar code: | CCGGTGCGTTCTGCCCGTACTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1083 |
LEAP-Seq percent confirming: | 99.6085 |
LEAP-Seq n confirming: | 7379 |
LEAP-Seq n nonconfirming: | 29 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGTTTTGTCAGAGGCTAGG |
Suggested primer 2: | GCTCACCAAGTTTGACACGA |