| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.110085 |
| Chromosome: | chromosome 4 |
| Location: | 3188549 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g226200 | (1 of 3) IPR000938 - CAP Gly-rich domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAGTACGCATGTGTACGAACAAGAAGACA |
| Internal bar code: | AGACCCGCCTCCCGGCCCTATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 210 |
| LEAP-Seq percent confirming: | 44.6536 |
| LEAP-Seq n confirming: | 1115 |
| LEAP-Seq n nonconfirming: | 1382 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATGATGCCAAGGTATGTG |
| Suggested primer 2: | AAGAAGTGAAGGCGTAGCCA |