Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.110160 |
Chromosome: | chromosome 1 |
Location: | 3834150 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g024800 | (1 of 2) PF00059//PF07714//PF14295 - Lectin C-type domain (Lectin_C) // Protein tyrosine kinase (Pkinase_Tyr) // PAN domain (PAN_4) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCTACATGCCGCCCGAGACTTTCAGTAG |
Internal bar code: | TACGTCCGTTTAACGGAACGAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 621 |
LEAP-Seq percent confirming: | 99.3891 |
LEAP-Seq n confirming: | 3091 |
LEAP-Seq n nonconfirming: | 19 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCTGCACCGTTTATTTGTT |
Suggested primer 2: | AACTCCTTGACAAACCCACG |