Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.110170 |
Chromosome: | chromosome 3 |
Location: | 6199504 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g192350 | (1 of 2) IPR006652//IPR015915 - Kelch repeat type 1 // Kelch-type beta propeller | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGGACGTGTCTGTACGGCGTTTACCTTCT |
Internal bar code: | CATCAATTTCTGGTACAAGGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 333 |
LEAP-Seq percent confirming: | 93.0969 |
LEAP-Seq n confirming: | 1470 |
LEAP-Seq n nonconfirming: | 109 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCGACAACACGTCAATCAAC |
Suggested primer 2: | ACAAACGCAGCGAGTTCTTT |