| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.110262 |
| Chromosome: | chromosome 3 |
| Location: | 8798048 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g205921 | (1 of 5) 3.1.13.5 - Ribonuclease D / RNase D | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCTGAAACCTTGAGCGGGCTAGAGCGGGC |
| Internal bar code: | GCCTTCTGGCGGTAACGGTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1132 |
| LEAP-Seq percent confirming: | 99.3923 |
| LEAP-Seq n confirming: | 3762 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTGTCAACGGCCATAGGTT |
| Suggested primer 2: | ATCGTCATTCTTCCCACAGC |