Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.110282 |
Chromosome: | chromosome 10 |
Location: | 3923292 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g448200 | ARL9 | ARF-like GTPase; (1 of 4) K07937 - ADP-ribosylation factor 1 (ARF1) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCTTCCTGCCGCGGAGGTGGCCCGACTC |
Internal bar code: | AAATTCAGTGATTCTAACCTTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 450 |
LEAP-Seq percent confirming: | 99.0291 |
LEAP-Seq n confirming: | 204 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCAGAGCCTGCGTGTAGGTA |
Suggested primer 2: | AACACCAACTGCATGGTTCA |