| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.110411 |
| Chromosome: | chromosome 16 |
| Location: | 3454178 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g670973 | GSTS3,GST3 | (1 of 3) 2.5.1.18//5.3.99.2 - Glutathione transferase / S-(hydroxyalkyl)glutathione lyase // Prostaglandin-D synthase / Prostaglandin-H(2) Delta-isomerase; Glutathione S-transferase, similar to Prostaglandin-D Synthase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCGTTGTAACTCGCTACCCACCACAAGC |
| Internal bar code: | TATTAAGGGCGCCTATGCCGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 839 |
| LEAP-Seq percent confirming: | 98.6667 |
| LEAP-Seq n confirming: | 74 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGCTTCGAGTTCAAAGGG |
| Suggested primer 2: | ACTCAGAAAATTGCCCATCG |