| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.110414 |
| Chromosome: | chromosome 4 |
| Location: | 1071717 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g216350 | AKR7,CPLD3 | Conserved in the Plant Lineage and Diatoms; (1 of 1) K05275 - pyridoxine 4-dehydrogenase (E1.1.1.65) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGCCCCTTGTTTTCTCAGCCTTGCACTTG |
| Internal bar code: | AAACTCGGACGAGCTTCGTTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 865 |
| LEAP-Seq percent confirming: | 99.7463 |
| LEAP-Seq n confirming: | 2359 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTTCTGCACCATGCTCTTC |
| Suggested primer 2: | GCAGCAGGACCTCAAGGTAG |