| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.110639 |
| Chromosome: | chromosome 12 |
| Location: | 3008603 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g500900 | PIAS1,SIZ1 | (1 of 1) K04706 - E3 SUMO-protein ligase PIAS1 (PIAS1); SUMO ligase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGATAGCTACCACCTGTGAGGACGGCGGGA |
| Internal bar code: | TACGTCTTGCGTCACAGGCCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 629 |
| LEAP-Seq percent confirming: | 99.1213 |
| LEAP-Seq n confirming: | 3497 |
| LEAP-Seq n nonconfirming: | 31 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATCCAGAAGCCACATGGAC |
| Suggested primer 2: | ACGGGCATGCAGGTAGTATC |