Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.110705 |
Chromosome: | chromosome 1 |
Location: | 5197068 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g036150 | (1 of 1) PTHR14095:SF0 - PROTEIN C06G1.5, ISOFORM B | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGATGACAACGCGTAGTCCATATAACGCA |
Internal bar code: | GATGCACCCGGTCGGACAGATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 344 |
LEAP-Seq percent confirming: | 96.8603 |
LEAP-Seq n confirming: | 617 |
LEAP-Seq n nonconfirming: | 20 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCGCTCAGACTTCCCTTGT |
Suggested primer 2: | TCTCTCCCACCACCACTAGG |