| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.110720 |
| Chromosome: | chromosome 12 |
| Location: | 7478882 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g556100 | DNAAF13,SPAG1 | Sperm-associated antigen 1; (1 of 1) PF00515//PF07719//PF13414//PF13877 - Tetratricopeptide repeat (TPR_1) // Tetratricopeptide repeat (TPR_2) // TPR repeat (TPR_11) // Potential Monad-binding region of RPAP3 (RPAP3_C) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCACTACCTGGCAACAGTCGAATCAAGCA |
| Internal bar code: | AAATACTACACAATAGTATCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 161 |
| LEAP-Seq percent confirming: | 99.7389 |
| LEAP-Seq n confirming: | 382 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCTCTGGAGTGCATAAACG |
| Suggested primer 2: | TCTCCTCCTCCACAACCATC |