| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.110803 |
| Chromosome: | chromosome 16 |
| Location: | 392843 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g693600 | ISG-C4,ISG4,FAP137 | Hydroxyproline-rich Flagellar Associated Protein137; (1 of 1) 2.7.11.1//2.7.11.18 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase // [Myosin light-chain] kinase / Smooth-muscle-myosin-light-chain kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCAAGCACGTCGATCACTGCGCTGCCGC |
| Internal bar code: | GTGCAGGATCAAGGACAGCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 491 |
| LEAP-Seq percent confirming: | 99.3886 |
| LEAP-Seq n confirming: | 1138 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGAGCATGGCTATCAAGCA |
| Suggested primer 2: | GAAGGAGCATGGGAAATGAA |