| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.110874 |
| Chromosome: | chromosome 1 |
| Location: | 2086589 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g011150 | (1 of 2) IPR000104//IPR011598 - Antifreeze protein, type I // Myc-type, basic helix-loop-helix (bHLH) domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTGTGCCCGGCACGGTTGCCCGGCGCCT |
| Internal bar code: | GTTTCGGGTTGCAACAACTCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 689 |
| LEAP-Seq percent confirming: | 98.2398 |
| LEAP-Seq n confirming: | 6474 |
| LEAP-Seq n nonconfirming: | 116 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGGAGTTGATGCCCTTCAG |
| Suggested primer 2: | ACACGTTGGTTGAGTCTCCC |