Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.110945 |
Chromosome: | chromosome 5 |
Location: | 2639890 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g236400 | NAT13 | (1 of 36) PF00583 - Acetyltransferase (GNAT) family (Acetyltransf_1); N-acetyltransferase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTACAGTCCGAGTTCCCCAATGACCCAGA |
Internal bar code: | AATTATCCTCTCAGTTTGGCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 162 |
LEAP-Seq percent confirming: | 99.7758 |
LEAP-Seq n confirming: | 6230 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGGGGAGTAGTGAGGAGGG |
Suggested primer 2: | TGTGGACCAAAACGTGAGAA |